Accession | MI0004134 | ||||
Name | mmu-mir-668 | ||||
similar to following miRCarta precursors | mmu-25247-964.1 | ||||
Organism | Mus musculus | ||||
Genome | GRCm38.p5 | ||||
Location |
chr12:109,734,732-109,734,797 (+) |
||||
miRNA | mmu-miR-668-5p | ||||
miRNA | mmu-miR-668-3p | ||||
Sequence (5' -> 3') (66 nts) |
GGUAAGUGUGCCUCGGGUGAGCAUGCACUUAAUGUAGGUGUAUGUCACUCGGCUCGGCCCACUACC | ||||
MFE | -33.50 kcal/mol | ||||
first miRBase version | 8.2 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (17 precursors) |
mmu-mir-381
mmu-mir-487b mmu-mir-539 mmu-mir-544 mmu-mir-382 mmu-mir-134 mmu-mir-668 mmu-mir-485 mmu-mir-453 mmu-mir-154 mmu-mir-496a mmu-mir-377 mmu-mir-541 mmu-mir-409 mmu-mir-412 mmu-mir-369 mmu-mir-410 |
||||
Family | mir-668 (MIPF0000357) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Berezikov et al. | Genome Res. | 2006 | 16954537 | Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis. |
2 | Mineno et al. | Nucleic Acids Res. | 2006 | 16582102 | The expression profile of microRNAs in mouse embryos. |
3 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |
4 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |