Accession | MI0001164 | ||||
Name | mmu-mir-412 | ||||
similar to following miRCarta precursors | mmu-25254-25253.1 | ||||
Organism | Mus musculus | ||||
Genome | GRCm38.p5 | ||||
Location |
chr12:109,743,289-109,743,368 (+) |
||||
miRNA | mmu-miR-412-5p | ||||
miRNA | mmu-miR-412-3p | ||||
Sequence (5' -> 3') (80 nts) |
GGGUAUGGGACGGAUGGUCGACCAGCUGGAAAGUAAUUGUUUCUAAUGUACUUCACCUGGUCCACUAGCCGUCGGUGCCC | ||||
MFE | -33.90 kcal/mol | ||||
first miRBase version | 5.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (14 precursors) |
mmu-mir-382
mmu-mir-134 mmu-mir-668 mmu-mir-485 mmu-mir-453 mmu-mir-154 mmu-mir-496a mmu-mir-377 mmu-mir-541 mmu-mir-409 mmu-mir-412 mmu-mir-369 mmu-mir-410 mmu-mir-3072 |
||||
Family | mir-412 (MIPF0000192) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Seitz et al. | Genome Res. | 2004 | 15310658 | A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain. |
2 | Sewer et al. | BMC Bioinformatics | 2005 | 16274478 | Identification of clustered microRNAs using an ab initio prediction method. |
3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
4 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
5 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |