Accession | MI0002406 | ||||
Name | mmu-mir-471 | ||||
similar to following miRCarta precursors | mmu-25672-25671.1 | ||||
Organism | Mus musculus | ||||
Genome | GRCm38.p5 | ||||
Location |
chrX:66,792,595-66,792,661 (-) |
||||
miRNA | mmu-miR-471-5p | ||||
miRNA | mmu-miR-471-3p | ||||
Sequence (5' -> 3') (67 nts) |
GUGCUUUACGUAGUAUAGUGCUUUUCACAUUAAACAAAAAGUGAAAGGUGCCAUACUAUGUAUAGGA | ||||
MFE | -25.80 kcal/mol | ||||
first miRBase version | 7.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (7 precursors) |
mmu-mir-883b
mmu-mir-471 mmu-mir-741 mmu-mir-463 mmu-mir-880 mmu-mir-878 mmu-mir-881 |
||||
Family | mir-471 (MIPF0000423) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Yu et al. | Biol. Reprod. | 2005 | 15901636 | MicroRNA Mirn122a reduces expression of the posttranscriptionally regulated germ cell transition protein 2 (Tnp2) messenger RNA (mRNA) by mRNA cleavage. |
2 | Watanabe et al. | Genes Dev. | 2006 | 16766679 | Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes. |
3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
4 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
5 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |