| Accession | MI0005548 | ||||||
| Name | mmu-mir-878 | ||||||
| similar to following miRCarta precursors | mmu-25680-25679.1 | ||||||
| Organism | Mus musculus | ||||||
| Genome | GRCm38.p5 | ||||||
| Location |
chrX:66,801,508-66,801,585 (-) |
||||||
| miRNA | mmu-miR-878-5p | ||||||
| miRNA | mmu-miR-878-3p | ||||||
| Sequence (5' -> 3') (78 nts) |
UGCAAUGCUUUAUCUAGUUGGAUGUCAAGACACGUGAAACUUAAGUGCAUGACACCACACUGGGUAGAGGAGGGCUCA | ||||||
| MFE | -26.10 kcal/mol | ||||||
| first miRBase version | 10.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (7 precursors) |
mmu-mir-471
mmu-mir-741 mmu-mir-463 mmu-mir-880 mmu-mir-878 mmu-mir-881 mmu-mir-871 |
||||||
| Family | mir-878 (MIPF0000434) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Berezikov et al. | Genome Res. | 2006 | 16954537 | Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis. |
| 2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 3 | Calabrese et al. | Proc. Natl. Acad. Sci. U.S.A. | 2007 | 17989215 | RNA sequence analysis defines Dicer's role in mouse embryonic stem cells. |
| 4 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
| 5 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |