| Accession | MI0001446 | ||||
| Name | hsa-mir-424 | ||||
| similar to following miRCarta precursors | hsa-152-305.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chrX:134,546,614-134,546,711 (-) |
||||
| miRNA | hsa-miR-424-5p | ||||
| miRNA | hsa-miR-424-3p | ||||
| Sequence (5' -> 3') (98 nts) |
CGAGGGGAUACAGCAGCAAUUCAUGUUUUGAAGUGUUCUAAAUGGUUCAAAACGUGAGGCGCUGCUAUACCCCCUCGUGGGGAAGGUAGAAGGUGGGG | ||||
| MFE | -41.80 kcal/mol | ||||
| first miRBase version | 5.1 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (6 precursors) |
hsa-mir-450b
hsa-mir-450a-1 hsa-mir-450a-2 hsa-mir-542 hsa-mir-503 hsa-mir-424 |
||||
| Family | mir-322 (MIPF0000164) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Kasashima et al. | Biochem. Biophys. Res. Commun. | 2004 | 15325244 | Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells. |
| 2 | Lui et al. | Cancer Res. | 2007 | 17616659 | Patterns of known and novel small RNAs in human cervical cancer. |
| 3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |