| Accession | MI0001652 | ||||
| Name | hsa-mir-450a-1 | ||||
| similar to following miRCarta precursors | hsa-288-1130.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chrX:134,540,341-134,540,431 (-) |
||||
| miRNA | hsa-miR-450a-5p | ||||
| miRNA | hsa-miR-450a-1-3p | ||||
| Sequence (5' -> 3') (91 nts) |
AAACGAUACUAAACUGUUUUUGCGAUGUGUUCCUAAUAUGCACUAUAAAUAUAUUGGGAACAUUUUGCAUGUAUAGUUUUGUAUCAAUAUA | ||||
| MFE | -34.70 kcal/mol | ||||
| first miRBase version | 6.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (6 precursors) |
hsa-mir-450b
hsa-mir-450a-1 hsa-mir-450a-2 hsa-mir-542 hsa-mir-503 hsa-mir-424 |
||||
| Family | mir-450 (MIPF0000128) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Xie et al. | Nature | 2005 | 15735639 | Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals. |
| 2 | Sewer et al. | BMC Bioinformatics | 2005 | 16274478 | Identification of clustered microRNAs using an ab initio prediction method. |
| 3 | Bentwich et al. | Nat. Genet. | 2005 | 15965474 | Identification of hundreds of conserved and nonconserved human microRNAs. |
| 4 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 5 | Plé et al. | PLoS ONE | 2012 | 23226537 | The repertoire and features of human platelet microRNAs. |