| Accession | MI0001161 | ||||||
| Name | mmu-mir-410 | ||||||
| similar to following miRCarta precursors | mmu-1129-302.1 | ||||||
| Organism | Mus musculus | ||||||
| Genome | GRCm38.p5 | ||||||
| Location |
chr12:109,743,715-109,743,795 (+) |
||||||
| miRNA | mmu-miR-410-5p | ||||||
| miRNA | mmu-miR-410-3p | ||||||
| Sequence (5' -> 3') (81 nts) |
GGGUACUUGAGGAGAGGUUGUCUGUGAUGAGUUCGCUUUAUUAAUGACGAAUAUAACACAGAUGGCCUGUUUUCAAUACCA | ||||||
| MFE | -34.00 kcal/mol | ||||||
| first miRBase version | 5.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (14 precursors) |
mmu-mir-382
mmu-mir-134 mmu-mir-668 mmu-mir-485 mmu-mir-453 mmu-mir-154 mmu-mir-496a mmu-mir-377 mmu-mir-541 mmu-mir-409 mmu-mir-412 mmu-mir-369 mmu-mir-410 mmu-mir-3072 |
||||||
| Family | mir-154 (MIPF0000018) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Seitz et al. | Genome Res. | 2004 | 15310658 | A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain. |
| 2 | Sewer et al. | BMC Bioinformatics | 2005 | 16274478 | Identification of clustered microRNAs using an ab initio prediction method. |
| 3 | Wheeler et al. | FEBS Lett. | 2006 | 16566924 | Identification of new central nervous system specific mouse microRNAs. |
| 4 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 5 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |
| 6 | Zhu et al. | J. Virol. | 2010 | 20668074 | Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68. |
| 7 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |