| Accession | MI0000719 | ||||||
| Name | mmu-mir-92a-1 | ||||||
| similar to following miRCarta precursors | mmu-25351-9.1 | ||||||
| Organism | Mus musculus | ||||||
| Genome | GRCm38.p5 | ||||||
| Location |
chr14:115,044,427-115,044,506 (+) |
||||||
| miRNA | mmu-miR-92a-1-5p | ||||||
| miRNA | mmu-miR-92a-3p | ||||||
| Sequence (5' -> 3') (80 nts) |
CUUUCUACACAGGUUGGGAUUUGUCGCAAUGCUGUGUUUCUCUGUAUGGUAUUGCACUUGUCCCGGCCUGUUGAGUUUGG | ||||||
| MFE | -34.00 kcal/mol | ||||||
| first miRBase version | 3.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (6 precursors) |
mmu-mir-17
mmu-mir-18a mmu-mir-19a mmu-mir-20a mmu-mir-19b-1 mmu-mir-92a-1 |
||||||
| Family | mir-25 (MIPF0000013) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Houbaviy et al. | Dev. Cell | 2003 | 12919684 | Embryonic stem cell-specific MicroRNAs. |
| 2 | Weber et al. | FEBS J. | 2005 | 15634332 | New human and mouse microRNA genes found by homology search. |
| 3 | Watanabe et al. | Genes Dev. | 2006 | 16766679 | Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes. |
| 4 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 5 | Zhu et al. | J. Virol. | 2010 | 20668074 | Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68. |
| 6 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
| 7 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |