Precursor miRBase

mmu-mir-17 (MI0000687)

Accession MI0000687
Name mmu-mir-17
similar to following miRCarta precursors mmu-88-25348.1
Organism Mus musculus
Genome GRCm38.p5
Location chr14:115,043,671-115,043,754 (+)
miRNA mmu-miR-17-5p
miRNA mmu-miR-17-3p
Sequence (5' -> 3')
(84 nts)
GUCAGAAUAAUGUCAAAGUGCUUACAGUGCAGGUAGUGAUGUGUGCAUCUACUGCAGUGAGGGCACUUGUAGCAUUAUGCUGAC
MFE -36.70 kcal/mol
first miRBase version 3.0
last miRBase version 21.0
Clusters (10 kb)
(6 precursors)
mmu-mir-17
mmu-mir-18a
mmu-mir-19a
mmu-mir-20a
mmu-mir-19b-1
mmu-mir-92a-1
Family mir-17 (MIPF0000001)
Experiments
experiment Pubmed link
Illumina 20215419 20413612
cloned 17604727 15538371
External DBs
Gene symbol Mir17
NCBI Gene 723905

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Lagos-Quintana et al. Science 2001 11679670 Identification of novel genes coding for small expressed RNAs.
2 Mourelatos et al. Genes Dev. 2002 11914277 miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs.
3 Poy et al. Nature 2004 15538371 A pancreatic islet-specific microRNA regulates insulin secretion.
4 Weber et al. FEBS J. 2005 15634332 New human and mouse microRNA genes found by homology search.
5 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
6 Ahn et al. Mol. Hum. Reprod. 2010 20215419 MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing.
7 Chiang et al. Genes Dev. 2010 20413612 Mammalian microRNAs: experimental evaluation of novel and previously annotated genes.