| Accession | MI0000652 | ||||
| Name | mmu-mir-1a-2 | ||||
| similar to following miRCarta precursors | mmu-25534-307.1 | ||||
| potential naming conflicts with | mmu-mir-1b (MI0000258) mmu-mir-1b (MI0006283) | ||||
| Organism | Mus musculus | ||||
| Genome | GRCm38.p5 | ||||
| Location |
chr18:10,785,481-10,785,552 (-) |
||||
| miRNA | mmu-miR-1a-2-5p | ||||
| miRNA | mmu-miR-1a-3p | ||||
| Sequence (5' -> 3') (72 nts) |
UCAGAGCACAUACUUCUUUAUGUACCCAUAUGAACAUUCAGUGCUAUGGAAUGUAAAGAAGUAUGUAUUUUG | ||||
| MFE | -24.70 kcal/mol | ||||
| first miRBase version | 2.2 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (3 precursors) |
mmu-mir-133a-1
mmu-mir-1b mmu-mir-1a-2 |
||||
| Family | mir-1 (MIPF0000038) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Lagos-Quintana et al. | Curr. Biol. | 2002 | 12007417 | Identification of tissue-specific microRNAs from mouse. |
| 2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 3 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |