Accession | MI0000159 | ||||||
Name | mmu-mir-133a-1 | ||||||
similar to following miRCarta precursors | mmu-25531-320.1 | ||||||
Organism | Mus musculus | ||||||
Genome | GRCm38.p5 | ||||||
Location |
chr18:10,782,909-10,782,976 (-) |
||||||
miRNA | mmu-miR-133a-5p | ||||||
miRNA | mmu-miR-133a-3p | ||||||
Sequence (5' -> 3') (68 nts) |
GCUAAAGCUGGUAAAAUGGAACCAAAUCGCCUCUUCAAUGGAUUUGGUCCCCUUCAACCAGCUGUAGC | ||||||
MFE | -28.20 kcal/mol | ||||||
first miRBase version | 1.1 | ||||||
last miRBase version | 21.0 | ||||||
Clusters (10 kb) (3 precursors) |
mmu-mir-133a-1 mmu-mir-1b mmu-mir-1a-2 |
||||||
Family | mir-133 (MIPF0000029) | ||||||
Experiments |
|
||||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Lagos-Quintana et al. | Curr. Biol. | 2002 | 12007417 | Identification of tissue-specific microRNAs from mouse. |
2 | Mineno et al. | Nucleic Acids Res. | 2006 | 16582102 | The expression profile of microRNAs in mouse embryos. |
3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
4 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
5 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |