| Accession | MI0004129 | ||||
| Name | mmu-mir-758 | ||||
| similar to following miRCarta precursors | mmu-25219-334.1 | ||||
| Organism | Mus musculus | ||||
| Genome | GRCm38.p5 | ||||
| Location |
chr12:109,712,810-109,712,890 (+) |
||||
| miRNA | mmu-miR-758-5p | ||||
| miRNA | mmu-miR-758-3p | ||||
| Sequence (5' -> 3') (81 nts) |
UGGGUGCGUGAGGUGGUUGACCAGAGAGCACACGCUAUAUUUGUGCCGUUUGUGACCUGGUCCACUAACCCUCAGUAUCUA | ||||
| MFE | -31.60 kcal/mol | ||||
| first miRBase version | 9.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (17 precursors) |
mmu-mir-379
mmu-mir-411 mmu-mir-299a mmu-mir-299b mmu-mir-380 mmu-mir-1197 mmu-mir-323 mmu-mir-758 mmu-mir-329 mmu-mir-494 mmu-mir-679 mmu-mir-1193 mmu-mir-666 mmu-mir-543 mmu-mir-495 mmu-mir-667 mmu-mir-376c |
||||
| Family | mir-379 (MIPF0000126) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Berezikov et al. | Genome Res. | 2006 | 16954537 | Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis. |
| 2 | Calabrese et al. | Proc. Natl. Acad. Sci. U.S.A. | 2007 | 17989215 | RNA sequence analysis defines Dicer's role in mouse embryonic stem cells. |
| 3 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
| 4 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |