| Accession | MI0000796 | ||||||
| Name | mmu-mir-379 | ||||||
| similar to following miRCarta precursors | mmu-101-645.1 | ||||||
| Organism | Mus musculus | ||||||
| Genome | GRCm38.p5 | ||||||
| Location |
chr12:109,709,060-109,709,125 (+) |
||||||
| miRNA | mmu-miR-379-5p | ||||||
| miRNA | mmu-miR-379-3p | ||||||
| Sequence (5' -> 3') (66 nts) |
AGAGAUGGUAGACUAUGGAACGUAGGCGUUAUGUUUUUGACCUAUGUAACAUGGUCCACUAACUCU | ||||||
| MFE | -27.10 kcal/mol | ||||||
| first miRBase version | 5.1 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (15 precursors) |
mmu-mir-379 mmu-mir-411 mmu-mir-299a mmu-mir-299b mmu-mir-380 mmu-mir-1197 mmu-mir-323 mmu-mir-758 mmu-mir-329 mmu-mir-494 mmu-mir-679 mmu-mir-1193 mmu-mir-666 mmu-mir-543 mmu-mir-495 |
||||||
| Family | mir-379 (MIPF0000126) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Poy et al. | Nature | 2004 | 15538371 | A pancreatic islet-specific microRNA regulates insulin secretion. |
| 2 | Sewer et al. | BMC Bioinformatics | 2005 | 16274478 | Identification of clustered microRNAs using an ab initio prediction method. |
| 3 | Watanabe et al. | Genes Dev. | 2006 | 16766679 | Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes. |
| 4 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 5 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |
| 6 | Zhu et al. | J. Virol. | 2010 | 20668074 | Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68. |
| 7 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |