| Accession | MI0003686 | ||||
| Name | hsa-mir-542 | ||||
| similar to following miRCarta precursors | hsa-463-136.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chrX:134,541,341-134,541,437 (-) |
||||
| miRNA | hsa-miR-542-5p | ||||
| miRNA | hsa-miR-542-3p | ||||
| Sequence (5' -> 3') (97 nts) |
CAGAUCUCAGACAUCUCGGGGAUCAUCAUGUCACGAGAUACCAGUGUGCACUUGUGACAGAUUGAUAACUGAAAGGUCUGGGAGCCACUCAUCUUCA | ||||
| MFE | -34.90 kcal/mol | ||||
| first miRBase version | 8.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (6 precursors) |
hsa-mir-450b
hsa-mir-450a-1 hsa-mir-450a-2 hsa-mir-542 hsa-mir-503 hsa-mir-424 |
||||
| Family | mir-542 (MIPF0000185) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Sewer et al. | BMC Bioinformatics | 2005 | 16274478 | Identification of clustered microRNAs using an ab initio prediction method. |
| 2 | Lui et al. | Cancer Res. | 2007 | 17616659 | Patterns of known and novel small RNAs in human cervical cancer. |
| 3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |