| Accession | MI0003536 | ||||||
| Name | mmu-mir-20b | ||||||
| similar to following miRCarta precursors | mmu-241-25640.1 | ||||||
| Organism | Mus musculus | ||||||
| Genome | GRCm38.p5 | ||||||
| Location |
chrX:52,742,113-52,742,192 (-) |
||||||
| miRNA | mmu-miR-20b-5p | ||||||
| miRNA | mmu-miR-20b-3p | ||||||
| Sequence (5' -> 3') (80 nts) |
CCUAGUAGUGCCAAAGUGCUCAUAGUGCAGGUAGUUUUUAUACCACUCUACUGCAGUGUGAGCACUUCUAGUACUCCUGG | ||||||
| MFE | -35.50 kcal/mol | ||||||
| first miRBase version | 8.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (6 precursors) |
mmu-mir-363
mmu-mir-92a-2 mmu-mir-19b-2 mmu-mir-20b mmu-mir-18b mmu-mir-106a |
||||||
| Family | mir-17 (MIPF0000001) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Sewer et al. | BMC Bioinformatics | 2005 | 16274478 | Identification of clustered microRNAs using an ab initio prediction method. |
| 2 | Mineno et al. | Nucleic Acids Res. | 2006 | 16582102 | The expression profile of microRNAs in mouse embryos. |
| 3 | Watanabe et al. | Genes Dev. | 2006 | 16766679 | Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes. |
| 4 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 5 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
| 6 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |