| Accession | MI0000546 | ||||
| Name | mmu-mir-19b-2 | ||||
| similar to following miRCarta precursors | mmu-25639-121.1 | ||||
| Organism | Mus musculus | ||||
| Genome | GRCm38.p5 | ||||
| Location |
chrX:52,741,983-52,742,066 (-) |
||||
| miRNA | mmu-miR-19b-2-5p | ||||
| miRNA | mmu-miR-19b-3p | ||||
| Sequence (5' -> 3') (84 nts) |
ACUUACGAUUAGUUUUGCAGAUUUGCAGUUCAGCGUAUAUGUGAAUAUAUGGCUGUGCAAAUCCAUGCAAAACUGAUUGUGGGA | ||||
| MFE | -40.80 kcal/mol | ||||
| first miRBase version | 2.1 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (6 precursors) |
mmu-mir-363
mmu-mir-92a-2 mmu-mir-19b-2 mmu-mir-20b mmu-mir-18b mmu-mir-106a |
||||
| Family | mir-19 (MIPF0000011) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Lagos-Quintana et al. | Curr. Biol. | 2002 | 12007417 | Identification of tissue-specific microRNAs from mouse. |
| 2 | Dostie et al. | RNA | 2003 | 12554860 | Numerous microRNPs in neuronal cells containing novel microRNAs. |
| 3 | Houbaviy et al. | Dev. Cell | 2003 | 12919684 | Embryonic stem cell-specific MicroRNAs. |
| 4 | Weber et al. | FEBS J. | 2005 | 15634332 | New human and mouse microRNA genes found by homology search. |
| 5 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 6 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
| 7 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |