| Accession | MI0003188 | ||||
| Name | hsa-mir-503 | ||||
| similar to following miRCarta precursors | hsa-297-625.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chrX:134,546,328-134,546,398 (-) |
||||
| miRNA | hsa-miR-503-5p | ||||
| miRNA | hsa-miR-503-3p | ||||
| Sequence (5' -> 3') (71 nts) |
UGCCCUAGCAGCGGGAACAGUUCUGCAGUGAGCGAUCGGUGCUCUGGGGUAUUGUUUCCGCUGCCAGGGUA | ||||
| MFE | -42.20 kcal/mol | ||||
| first miRBase version | 7.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (6 precursors) |
hsa-mir-450b
hsa-mir-450a-1 hsa-mir-450a-2 hsa-mir-542 hsa-mir-503 hsa-mir-424 |
||||
| Family | mir-503 (MIPF0000183) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Sewer et al. | BMC Bioinformatics | 2005 | 16274478 | Identification of clustered microRNAs using an ab initio prediction method. |
| 2 | Bentwich et al. | Nat. Genet. | 2005 | 15965474 | Identification of hundreds of conserved and nonconserved human microRNAs. |
| 3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 4 | Voellenkle et al. | RNA | 2012 | 22282338 | Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs. |