| Accession | MI0003162 | ||||
| Name | hsa-mir-519d | ||||
| similar to following miRCarta precursors | hsa-984-894.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr19:53,713,347-53,713,434 (+) |
||||
| miRNA | hsa-miR-519d-5p | ||||
| miRNA | hsa-miR-519d-3p | ||||
| Sequence (5' -> 3') (88 nts) |
UCCCAUGCUGUGACCCUCCAAAGGGAAGCGCUUUCUGUUUGUUUUCUCUUAAACAAAGUGCCUCCCUUUAGAGUGUUACCGUUUGGGA | ||||
| MFE | -41.20 kcal/mol | ||||
| first miRBase version | 7.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (10 precursors) |
hsa-mir-526a-1
hsa-mir-520c hsa-mir-518c hsa-mir-524 hsa-mir-517a hsa-mir-519d hsa-mir-521-2 hsa-mir-520d hsa-mir-517b hsa-mir-520g |
||||
| Family | mir-515 (MIPF0000020) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Bentwich et al. | Nat. Genet. | 2005 | 15965474 | Identification of hundreds of conserved and nonconserved human microRNAs. |
| 2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 3 | Meunier et al. | Genome Res. | 2013 | 23034410 | Birth and expression evolution of mammalian microRNA genes. |