Accession | MI0003166 | ||||
Name | hsa-mir-520g | ||||
similar to following miRCarta precursors | hsa-1079-895.1 | ||||
Organism | Homo sapiens | ||||
Genome | GRCh38.p10 | ||||
Location |
chr19:53,722,166-53,722,255 (+) |
||||
miRNA | hsa-miR-520g-5p | ||||
miRNA | hsa-miR-520g-3p | ||||
Sequence (5' -> 3') (90 nts) |
UCCCAUGCUGUGACCCUCUAGAGGAAGCACUUUCUGUUUGUUGUCUGAGAAAAAACAAAGUGCUUCCCUUUAGAGUGUUACCGUUUGGGA | ||||
MFE | -41.60 kcal/mol | ||||
first miRBase version | 7.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (10 precursors) |
hsa-mir-517a
hsa-mir-519d hsa-mir-521-2 hsa-mir-520d hsa-mir-517b hsa-mir-520g hsa-mir-516b-2 hsa-mir-526a-2 hsa-mir-518e hsa-mir-518a-1 |
||||
Family | mir-515 (MIPF0000020) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Bentwich et al. | Nat. Genet. | 2005 | 15965474 | Identification of hundreds of conserved and nonconserved human microRNAs. |
2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
3 | Meunier et al. | Genome Res. | 2013 | 23034410 | Birth and expression evolution of mammalian microRNA genes. |