| Accession | MI0000799 | ||||||
| Name | mmu-mir-382 | ||||||
| similar to following miRCarta precursors | mmu-274-25245.1 | ||||||
| Organism | Mus musculus | ||||||
| Genome | GRCm38.p5 | ||||||
| Location |
chr12:109,733,771-109,733,846 (+) |
||||||
| miRNA | mmu-miR-382-5p | ||||||
| miRNA | mmu-miR-382-3p | ||||||
| Sequence (5' -> 3') (76 nts) |
UACUUGAAGAGAAGUUGUUCGUGGUGGAUUCGCUUUACUUGUGACGAAUCAUUCACGGACAACACUUUUUUCAGUA | ||||||
| MFE | -28.40 kcal/mol | ||||||
| first miRBase version | 5.1 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (19 precursors) |
mmu-mir-376a
mmu-mir-300 mmu-mir-381 mmu-mir-487b mmu-mir-539 mmu-mir-544 mmu-mir-382 mmu-mir-134 mmu-mir-668 mmu-mir-485 mmu-mir-453 mmu-mir-154 mmu-mir-496a mmu-mir-377 mmu-mir-541 mmu-mir-409 mmu-mir-412 mmu-mir-369 mmu-mir-410 |
||||||
| Family | mir-154 (MIPF0000018) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Poy et al. | Nature | 2004 | 15538371 | A pancreatic islet-specific microRNA regulates insulin secretion. |
| 2 | Sewer et al. | BMC Bioinformatics | 2005 | 16274478 | Identification of clustered microRNAs using an ab initio prediction method. |
| 3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 4 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
| 5 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |