| Accession | MI0000797 | ||||||||||
| Name | mmu-mir-380 | ||||||||||
| similar to following miRCarta precursors | mmu-762-25217.1 | ||||||||||
| Organism | Mus musculus | ||||||||||
| Genome | GRCm38.p5 | ||||||||||
| Location |
chr12:109,711,803-109,711,863 (+) |
||||||||||
| miRNA | mmu-miR-380-5p | ||||||||||
| miRNA | mmu-miR-380-3p | ||||||||||
| Sequence (5' -> 3') (61 nts) |
AAGAUGGUUGACCAUAGAACAUGCGCUACUUCUGUGUCGUAUGUAGUAUGGUCCACAUCUU | ||||||||||
| MFE | -27.90 kcal/mol | ||||||||||
| first miRBase version | 5.0 | ||||||||||
| last miRBase version | 21.0 | ||||||||||
| Clusters (10 kb) (16 precursors) |
mmu-mir-379
mmu-mir-411 mmu-mir-299a mmu-mir-299b mmu-mir-380 mmu-mir-1197 mmu-mir-323 mmu-mir-758 mmu-mir-329 mmu-mir-494 mmu-mir-679 mmu-mir-1193 mmu-mir-666 mmu-mir-543 mmu-mir-495 mmu-mir-667 |
||||||||||
| Family | mir-379 (MIPF0000126) | ||||||||||
| Experiments |
|
||||||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Poy et al. | Nature | 2004 | 15538371 | A pancreatic islet-specific microRNA regulates insulin secretion. |
| 2 | Seitz et al. | Genome Res. | 2004 | 15310658 | A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain. |
| 3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 4 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |
| 5 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |