| Accession | MI0000605 | ||||||
| Name | mmu-mir-329 | ||||||
| similar to following miRCarta precursors | mmu-25221-25220.1 | ||||||
| Organism | Mus musculus | ||||||
| Genome | GRCm38.p5 | ||||||
| Location |
chr12:109,713,481-109,713,577 (+) |
||||||
| miRNA | mmu-miR-329-5p | ||||||
| miRNA | mmu-miR-329-3p | ||||||
| Sequence (5' -> 3') (97 nts) |
UGUUCGCUUCUGGUACCGGAAGAGAGGUUUUCUGGGUCUCUGUUUCUUUGAUGAGAAUGAAACACACCCAGCUAACCUUUUUUUCAGUAUCAAAUCC | ||||||
| MFE | -37.40 kcal/mol | ||||||
| first miRBase version | 3.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (19 precursors) |
mmu-mir-379
mmu-mir-411 mmu-mir-299a mmu-mir-299b mmu-mir-380 mmu-mir-1197 mmu-mir-323 mmu-mir-758 mmu-mir-329 mmu-mir-494 mmu-mir-679 mmu-mir-1193 mmu-mir-666 mmu-mir-543 mmu-mir-495 mmu-mir-667 mmu-mir-376c mmu-mir-654 mmu-mir-376b |
||||||
| Family | mir-329 (MIPF0000110) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Kim et al. | Proc. Natl. Acad. Sci. U.S.A. | 2004 | 14691248 | Identification of many microRNAs that copurify with polyribosomes in mammalian neurons. |
| 2 | Seitz et al. | Genome Res. | 2004 | 15310658 | A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain. |
| 3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 4 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
| 5 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |
| 6 | Zhu et al. | J. Virol. | 2010 | 20668074 | Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68. |