Precursor miRBase

hsa-mir-24-1 (MI0000080)

Accession MI0000080
Name hsa-mir-24-1
similar to following miRCarta precursors hsa-283-35.1
Organism Homo sapiens
Genome GRCh38.p10
Location chr9:95,086,021-95,086,088 (+)
miRNA hsa-miR-24-1-5p
miRNA hsa-miR-24-3p
Sequence (5' -> 3')
(68 nts)
CUCCGGUGCCUACUGAGCUGAUAUCAGUUCUCAUUUUACACACUGGCUCAGUUCAGCAGGAACAGGAG
MFE -26.30 kcal/mol
first miRBase version 1.1
last miRBase version 21.0
Clusters (10 kb)
(4 precursors)
hsa-mir-23b
hsa-mir-27b
hsa-mir-3074
hsa-mir-24-1
Family mir-24 (MIPF0000041)
Experiments
experiment Pubmed link
Illumina 20158877
cloned 11679670 15978578 14573789 17604727 17616659
Northern blot 11679670
External DBs
Gene symbol MIR24-1
NCBI Gene 407012

External tools

Links
HMDD

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Lagos-Quintana et al. Science 2001 11679670 Identification of novel genes coding for small expressed RNAs.
2 Mourelatos et al. Genes Dev. 2002 11914277 miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs.
3 Lagos-Quintana et al. RNA 2003 12554859 New microRNAs from mouse and human.
4 Michael et al. Mol. Cancer Res. 2003 14573789 Reduced accumulation of specific microRNAs in colorectal neoplasia.
5 Kasashima et al. Biochem. Biophys. Res. Commun. 2004 15325244 Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells.
6 Fu et al. FEBS Lett. 2005 15978578 Identification of human fetal liver miRNAs by a novel method.
7 Lui et al. Cancer Res. 2007 17616659 Patterns of known and novel small RNAs in human cervical cancer.
8 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
9 Koh et al. BMC Genomics 2010 20158877 Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha.