| Accession | MI0000080 | ||||||||
| Name | hsa-mir-24-1 | ||||||||
| similar to following miRCarta precursors | hsa-283-35.1 | ||||||||
| Organism | Homo sapiens | ||||||||
| Genome | GRCh38.p10 | ||||||||
| Location |
chr9:95,086,021-95,086,088 (+) |
||||||||
| miRNA | hsa-miR-24-1-5p | ||||||||
| miRNA | hsa-miR-24-3p | ||||||||
| Sequence (5' -> 3') (68 nts) |
CUCCGGUGCCUACUGAGCUGAUAUCAGUUCUCAUUUUACACACUGGCUCAGUUCAGCAGGAACAGGAG | ||||||||
| MFE | -26.30 kcal/mol | ||||||||
| first miRBase version | 1.1 | ||||||||
| last miRBase version | 21.0 | ||||||||
| Clusters (10 kb) (4 precursors) |
hsa-mir-23b
hsa-mir-27b hsa-mir-3074 hsa-mir-24-1 |
||||||||
| Family | mir-24 (MIPF0000041) | ||||||||
| Experiments |
|
||||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Lagos-Quintana et al. | Science | 2001 | 11679670 | Identification of novel genes coding for small expressed RNAs. |
| 2 | Mourelatos et al. | Genes Dev. | 2002 | 11914277 | miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs. |
| 3 | Lagos-Quintana et al. | RNA | 2003 | 12554859 | New microRNAs from mouse and human. |
| 4 | Michael et al. | Mol. Cancer Res. | 2003 | 14573789 | Reduced accumulation of specific microRNAs in colorectal neoplasia. |
| 5 | Kasashima et al. | Biochem. Biophys. Res. Commun. | 2004 | 15325244 | Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells. |
| 6 | Fu et al. | FEBS Lett. | 2005 | 15978578 | Identification of human fetal liver miRNAs by a novel method. |
| 7 | Lui et al. | Cancer Res. | 2007 | 17616659 | Patterns of known and novel small RNAs in human cervical cancer. |
| 8 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 9 | Koh et al. | BMC Genomics | 2010 | 20158877 | Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha. |