Accession | MI0000440 | ||||
Name | hsa-mir-27b | ||||
similar to following miRCarta precursors | hsa-240-39.1 | ||||
Organism | Homo sapiens | ||||
Genome | GRCh38.p10 | ||||
Location |
chr9:95,085,445-95,085,541 (+) |
||||
miRNA | hsa-miR-27b-5p | ||||
miRNA | hsa-miR-27b-3p | ||||
Sequence (5' -> 3') (97 nts) |
ACCUCUCUAACAAGGUGCAGAGCUUAGCUGAUUGGUGAACAGUGAUUGGUUUCCGCUUUGUUCACAGUGGCUAAGUUCUGCACCUGAAGAGAAGGUG | ||||
MFE | -49.40 kcal/mol | ||||
first miRBase version | 2.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (4 precursors) |
hsa-mir-23b
hsa-mir-27b hsa-mir-3074 hsa-mir-24-1 |
||||
Family | mir-27 (MIPF0000036) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Lagos-Quintana et al. | Curr. Biol. | 2002 | 12007417 | Identification of tissue-specific microRNAs from mouse. |
2 | Dostie et al. | RNA | 2003 | 12554860 | Numerous microRNPs in neuronal cells containing novel microRNAs. |
3 | Michael et al. | Mol. Cancer Res. | 2003 | 14573789 | Reduced accumulation of specific microRNAs in colorectal neoplasia. |
4 | Lui et al. | Cancer Res. | 2007 | 17616659 | Patterns of known and novel small RNAs in human cervical cancer. |
5 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |