| Accession | MIMAT0000063 | ||||||
| Name | hsa-let-7b-5p | ||||||
| similar to following miRCarta miRNAs |
m-14 |
||||||
| potential naming conflicts with | hsa-let-7b (MI0000063) | ||||||
| Organism | Homo sapiens | ||||||
| Genome | GRCh38.p10 | ||||||
| Sequence (5' -> 3') (22 nts) |
UGAGGUAGUAGGUUGUGUGGUU | ||||||
| Located in precursor | hsa-let-7b (MI0000063) chr22:46,113,691-46,113,712 (+) |
||||||
| MFE | 0.00 kcal/mol | ||||||
| first miRBase version | 1.1 | ||||||
| last miRBase version | 21.0 | ||||||
| Experiments |
|
| experimental | ||
| miRTarBase v6.1 | 1171 | |
| predicted | ||
| microT-CDS v5.0 (score ≥ 0.7) | 975 | |
| TargetScan v7.1 | 1170 |
| Links |
miRNA pathway dictionary (miRPathDB)
miRTargetLink Human Tissue Atlas miR2Disease |
| Experimentally supported targets |
TarBase
miRTarBase |
| Predicted targets | MicroT-CDS |