| Accession | MIMAT0001343 | ||||
| Name | hsa-miR-425-3p | ||||
| similar to following miRCarta miRNAs |
m-258 |
||||
| potential naming conflicts with | hsa-miR-425-5p (MIMAT0003393) | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Sequence (5' -> 3') (22 nts) |
AUCGGGAAUGUCGUGUCCGCCC | ||||
| Located in precursor | hsa-mir-425 (MI0001448) chr3:49,020,159-49,020,180 (-) |
||||
| MFE | -2.10 kcal/mol | ||||
| first miRBase version | 5.1 | ||||
| last miRBase version | 21.0 | ||||
| Experiments |
|
| experimental | ||
| miRTarBase v6.1 | 43 | |
| predicted | ||
| microT-CDS v5.0 (score ≥ 0.7) | 35 | |
| TargetScan v7.1 | 0 |
| Links |
miRNA pathway dictionary (miRPathDB)
miRTargetLink Human Tissue Atlas miR2Disease |
| Experimentally supported targets |
TarBase
miRTarBase |
| Predicted targets | MicroT-CDS |