Precursor miRBase

hsa-let-7a-1 (MI0000060)

Accession MI0000060
Name hsa-let-7a-1
similar to following miRCarta precursors hsa-4-181.1
Organism Homo sapiens
Genome GRCh38.p10
Location chr9:94,175,957-94,176,036 (+)
miRNA hsa-let-7a-5p
miRNA hsa-let-7a-3p
Sequence (5' -> 3')
(80 nts)
UGGGAUGAGGUAGUAGGUUGUAUAGUUUUAGGGUCACACCCACCACUGGGAGAUAACUAUACAAUCUACUGUCUUUCCUA
MFE -34.20 kcal/mol
first miRBase version 1.1
last miRBase version 21.0
Clusters (10 kb)
(3 precursors)
hsa-let-7a-1
hsa-let-7f-1
hsa-let-7d
Family let-7 (MIPF0000002)
Experiments
experiment Pubmed link
cloned 17604727
External DBs
Gene symbol MIRLET7A1
NCBI Gene 406881

External tools

Links
HMDD

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Lagos-Quintana et al. Science 2001 11679670 Identification of novel genes coding for small expressed RNAs.
2 Dostie et al. RNA 2003 12554860 Numerous microRNPs in neuronal cells containing novel microRNAs.
3 Michael et al. Mol. Cancer Res. 2003 14573789 Reduced accumulation of specific microRNAs in colorectal neoplasia.
4 Suh et al. Dev. Biol. 2004 15183728 Human embryonic stem cells express a unique set of microRNAs.
5 Kasashima et al. Biochem. Biophys. Res. Commun. 2004 15325244 Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells.
6 Lui et al. Cancer Res. 2007 17616659 Patterns of known and novel small RNAs in human cervical cancer.
7 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
8 Marton et al. Leukemia 2008 17989717 Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis.
9 Koh et al. BMC Genomics 2010 20158877 Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha.