Accession | hsa-13520-16155.1 |
Organism | Homo sapiens |
Genome | GRCh38.p10 |
Location | 8:88,503,759-88,503,817 (+) |
miRNA | m-13520 |
miRNA | m-16155 |
Sequence (5' -> 3') (59 nts) |
AUCAGGAUUCUGGAAUGGGCCUGCUUGUUUAGUGUUGGUCCAUUCCAGAAUCCUGAUAU |
MFE | -39.70 kcal/mol |
first miRCarta version | 1.0 |
last miRCarta version | 1.1 |
Clusters (10 kb) (1 precursors) |
hsa-13520-16155.1 |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Fehlmann et al. | Bioinformatics | 2018 | 29281000 | A high-resolution map of the human small non-coding transcriptome. |