Accession | hsa-7804-22449.1 |
Organism | Homo sapiens |
Genome | GRCh38.p10 |
Location | 7:30,093,408-30,093,462 (-) |
miRNA | m-7804 |
miRNA | m-22449 |
Sequence (5' -> 3') (55 nts) |
GUGGUAAGGCUGUGGGCUUAGAGGCAGGCUGUCUGGGCUCACAGUCCUACCACUC |
MFE | -33.40 kcal/mol |
first miRCarta version | 1.0 |
last miRCarta version | 1.1 |
Clusters (10 kb) (1 precursors) |
hsa-7804-22449.1 |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Fehlmann et al. | Bioinformatics | 2018 | 29281000 | A high-resolution map of the human small non-coding transcriptome. |