| Accession | hsa-7440-13610.1 |
| Organism | Homo sapiens |
| Genome | GRCh38.p10 |
| Location | 3:129,893,692-129,893,750 (-) |
| miRNA | m-7440 |
| miRNA | m-13610 |
| Sequence (5' -> 3') (59 nts) |
GGCGGUGGCGGCUGUGGCGGGGGCGCGCGCGCGCUCGCUCUCUCGCGCCGGUUCGCCCU |
| MFE | -32.80 kcal/mol |
| first miRCarta version | 1.0 |
| last miRCarta version | 1.1 |
| Clusters (10 kb) (2 precursors) |
hsa-13690-22217.1
hsa-7440-13610.1 |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Fehlmann et al. | Bioinformatics | 2018 | 29281000 | A high-resolution map of the human small non-coding transcriptome. |