Accession | hsa-10145-15417.1 |
Organism | Homo sapiens |
Genome | GRCh38.p10 |
Location | 14:100,882,673-100,882,729 (-) |
miRNA | m-10145 |
miRNA | m-15417 |
Sequence (5' -> 3') (57 nts) |
AAGCAGCGUUUGGUUUGGAGCUUGAAGAGAUGAAGAGCUACCAGCCGUUUGCGCUCU |
MFE | -18.40 kcal/mol |
first miRCarta version | 1.0 |
last miRCarta version | 1.1 |
Clusters (10 kb) (8 precursors) |
hsa-900-276.1
hsa-948.1 hsa-514-358.1 hsa-977-533.1 hsa-10145-15417.1 hsa-164-80.1 hsa-327-1223.1 hsa-269-322.1 |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Fehlmann et al. | Bioinformatics | 2018 | 29281000 | A high-resolution map of the human small non-coding transcriptome. |