| Accession | hsa-10456-7717.1 |
| Organism | Homo sapiens |
| Genome | GRCh38.p10 |
| Location | 10:101,038,584-101,038,641 (+) |
| miRNA | m-10456 |
| miRNA | m-7717 |
| Sequence (5' -> 3') (58 nts) |
UGGGGUGACAGUGAGGCAGGGGACACAAGCCGUUCCAUUGUCUUUCUGUCUCUCCACA |
| MFE | -29.40 kcal/mol |
| first miRCarta version | 1.0 |
| last miRCarta version | 1.1 |
| Clusters (10 kb) (1 precursors) |
hsa-10456-7717.1 |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Fehlmann et al. | Bioinformatics | 2018 | 29281000 | A high-resolution map of the human small non-coding transcriptome. |