| Accession | hsa-6997.1 |
| Organism | Homo sapiens |
| Genome | GRCh38.p10 |
| Location | X:154,436,854-154,436,910 (+) |
| miRNA | m-6997 |
| Sequence (5' -> 3') (57 nts) |
GGGCGGGGCGGGGCGGGGCGCGGCGGGUGGGGCGGGGCGCGCGCGGCUCCCGCGCAC |
| MFE | -28.60 kcal/mol |
| first miRCarta version | 1.0 |
| last miRCarta version | 1.1 |
| Clusters (10 kb) (2 precursors) |
hsa-6997.1 hsa-13003-19401.1 |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Londin et al. | Proc. Natl. Acad. Sci. U.S.A. | 2015 | 25713380 | Analysis of 13 cell types reveals evidence for the expression of numerous novel primate- and tissue-specific microRNAs. |