| Accession | hsa-2801.1 |
| Organism | Homo sapiens |
| Genome | GRCh38.p10 |
| Location | X:134,541,341-134,541,442 (-) |
| miRNA | m-2801 |
| Sequence (5' -> 3') (102 nts) |
AUGCACAGAUCUCAGACAUCUCGGGGAUCAUCAUGUCACGAGAUACCAGUGUGCACUUGUGACAGAUUGAUAACUGAAAGGUCUGGGAGCCACUCAUCUUCA |
| MFE | -35.00 kcal/mol |
| first miRCarta version | 1.0 |
| last miRCarta version | 1.1 |
| Clusters (10 kb) (8 precursors) |
hsa-266-1870.1
hsa-1130.1 hsa-288-1130.1 hsa-287-1126.1 hsa-2801.1 hsa-463-136.1 hsa-297-625.1 hsa-152-305.1 |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Londin et al. | Proc. Natl. Acad. Sci. U.S.A. | 2015 | 25713380 | Analysis of 13 cell types reveals evidence for the expression of numerous novel primate- and tissue-specific microRNAs. |