Accession | hsa-1130.1 |
Organism | Homo sapiens |
Genome | GRCh38.p10 |
Location | X:134,540,341-134,540,431 (-) |
miRNA | m-1130 |
Sequence (5' -> 3') (91 nts) |
AAACGAUACUAAACUGUUUUUGCGAUGUGUUCCUAAUAUGCACUAUAAAUAUAUUGGGAACAUUUUGCAUGUAUAGUUUUGUAUCAAUAUA |
MFE | -34.70 kcal/mol |
first miRCarta version | 1.0 |
last miRCarta version | 1.1 |
Clusters (10 kb) (8 precursors) |
hsa-266-1870.1
hsa-1130.1 hsa-288-1130.1 hsa-287-1126.1 hsa-2801.1 hsa-463-136.1 hsa-297-625.1 hsa-152-305.1 |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Londin et al. | Proc. Natl. Acad. Sci. U.S.A. | 2015 | 25713380 | Analysis of 13 cell types reveals evidence for the expression of numerous novel primate- and tissue-specific microRNAs. |