| Accession | hsa-5275.1 |
| Organism | Homo sapiens |
| Genome | GRCh38.p10 |
| Location | 7:5,491,614-5,491,674 (-) |
| miRNA | m-5275 |
| Sequence (5' -> 3') (61 nts) |
AUCAGGCCCACCGGGUCGCCUCCAAAUCAGAUCUCCAAGGGGGACCCUGGGGGCCUGAGUC |
| MFE | -33.50 kcal/mol |
| first miRCarta version | 1.0 |
| last miRCarta version | 1.1 |
| Clusters (10 kb) (2 precursors) |
hsa-5275.1 hsa-162-331.1 |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Londin et al. | Proc. Natl. Acad. Sci. U.S.A. | 2015 | 25713380 | Analysis of 13 cell types reveals evidence for the expression of numerous novel primate- and tissue-specific microRNAs. |