| Accession | hsa-2906.1 |
| Organism | Homo sapiens |
| Genome | GRCh38.p10 |
| Location | 6:33,201,672-33,201,740 (+) |
| miRNA | m-2906 |
| Sequence (5' -> 3') (69 nts) |
AUGGGAGAGAGAAGGGCUGGUUCUGGAUUGUUGGGAAACUCCACAGUACUUGACCUUGACUCUCCCUCA |
| MFE | -27.00 kcal/mol |
| first miRCarta version | 1.0 |
| last miRCarta version | 1.1 |
| Clusters (10 kb) (7 precursors) |
hsa-3791-3638.1
hsa-2906.1 hsa-12185-21790.1 hsa-20203-20105.1 hsa-569-438.1 hsa-2807-2956.1 hsa-6573-4912.1 |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Londin et al. | Proc. Natl. Acad. Sci. U.S.A. | 2015 | 25713380 | Analysis of 13 cell types reveals evidence for the expression of numerous novel primate- and tissue-specific microRNAs. |