| Accession | hsa-2749-2761.1 |
| Organism | Homo sapiens |
| Genome | GRCh38.p10 |
| Location | 21:8,987,471-8,987,532 (+) |
| miRNA | m-2749 |
| miRNA | m-2761 |
| Sequence (5' -> 3') (62 nts) |
CCCGGGUCGGGGGGUGGGGCCCGGGCCGGGGCCUCGGCCCCGGUCGCGGUCCCCCGUCCCGG |
| MFE | -51.10 kcal/mol |
| first miRCarta version | 1.0 |
| last miRCarta version | 1.1 |
| Clusters (10 kb) (9 precursors) |
hsa-2977.1
hsa-1017.2 hsa-2962.1 hsa-3058.1 hsa-668.2 hsa-2749-2761.1 hsa-2889-2766.1 hsa-3089.1 hsa-3116.1 |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Londin et al. | Proc. Natl. Acad. Sci. U.S.A. | 2015 | 25713380 | Analysis of 13 cell types reveals evidence for the expression of numerous novel primate- and tissue-specific microRNAs. |