| Accession | hsa-6814.1 |
| Organism | Homo sapiens |
| Genome | GRCh38.p10 |
| Location | 2:231,186,064-231,186,132 (-) |
| miRNA | m-6814 |
| Sequence (5' -> 3') (69 nts) |
UGGGCAGGGAGGCACAGGAUGACCCGGAUGAGUUACCACCCUGUCCUGUGUCUCCAUUUCCCCUUCAGC |
| MFE | -28.80 kcal/mol |
| first miRCarta version | 1.0 |
| last miRCarta version | 1.1 |
| Clusters (10 kb) (2 precursors) |
hsa-21712-8698.1
hsa-6814.1 |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Londin et al. | Proc. Natl. Acad. Sci. U.S.A. | 2015 | 25713380 | Analysis of 13 cell types reveals evidence for the expression of numerous novel primate- and tissue-specific microRNAs. |