Accession | hsa-3047.1 |
Organism | Homo sapiens |
Genome | GRCh38.p10 |
Location | 2:219,294,111-219,294,185 (-) |
miRNA | m-3047 |
Sequence (5' -> 3') (75 nts) |
GUCAUUUUUGUGAUCUGCAGCUAGUAUUCUCACUCCAGUUGCAUAGUCACAAAAGUGAUCAUUGGCAGGUGUGGC |
MFE | -25.30 kcal/mol |
first miRCarta version | 1.0 |
last miRCarta version | 1.1 |
Clusters (10 kb) (3 precursors) |
hsa-18360-16474.1
hsa-501.1 hsa-3047.1 |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Londin et al. | Proc. Natl. Acad. Sci. U.S.A. | 2015 | 25713380 | Analysis of 13 cell types reveals evidence for the expression of numerous novel primate- and tissue-specific microRNAs. |