| Accession | hsa-3133.1 |
| Organism | Homo sapiens |
| Genome | GRCh38.p10 |
| Location | 2:55,982,967-55,983,076 (-) |
| miRNA | m-3133 |
| Sequence (5' -> 3') (110 nts) |
AGUAUAAUUAUUACAUAGUUUUUGAUGUCGCAGAUACUGCAUCAGGAACUGAUUGGAUAAGAAUCAGUCACCAUCAGUUCCUAAUGCAUUGCCUUCAGCAUCUAAACAAG |
| MFE | -29.60 kcal/mol |
| first miRCarta version | 1.0 |
| last miRCarta version | 1.1 |
| Clusters (10 kb) (3 precursors) |
hsa-311.1
hsa-3133.1 hsa-778-957.1 |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Londin et al. | Proc. Natl. Acad. Sci. U.S.A. | 2015 | 25713380 | Analysis of 13 cell types reveals evidence for the expression of numerous novel primate- and tissue-specific microRNAs. |