| Accession | hsa-3012.1 |
| Organism | Homo sapiens |
| Genome | GRCh38.p10 |
| Location | 19:53,702,750-53,702,819 (+) |
| miRNA | m-3012 |
| Sequence (5' -> 3') (70 nts) |
CUCCAGAGGGAAGCGCUUUCUGUUGUCUGAAAGAAAACAAAGCGCUCCCCUUUAGAGGUUUACGGUUUGA |
| MFE | -26.40 kcal/mol |
| first miRCarta version | 1.0 |
| last miRCarta version | 1.1 |
| Clusters (10 kb) (13 precursors) |
hsa-857-949.1
hsa-733-938.1 hsa-879-942.1 hsa-733-928.1 hsa-877-903.1 hsa-899.1 hsa-3012.1 hsa-864.1 hsa-896.1 hsa-896-899.1 hsa-907-878.1 hsa-906-990.1 hsa-933-854.1 |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Londin et al. | Proc. Natl. Acad. Sci. U.S.A. | 2015 | 25713380 | Analysis of 13 cell types reveals evidence for the expression of numerous novel primate- and tissue-specific microRNAs. |