| Accession | hsa-5040.1 |
| Organism | Homo sapiens |
| Genome | GRCh38.p10 |
| Location | 16:2,271,747-2,271,840 (+) |
| miRNA | m-5040 |
| Sequence (5' -> 3') (94 nts) |
GUGAGGUGUGGGCCCGGCCCCAGGAGCGGGGCCUGGGCAGCCCCGUGUGUUGAGGAAGGAAGGCAGGGCCCCCGCUCCCCGGGCCUGACCCCAC |
| MFE | -51.70 kcal/mol |
| first miRCarta version | 1.0 |
| last miRCarta version | 1.1 |
| Clusters (10 kb) (6 precursors) |
hsa-18317-8532.1
hsa-685-443.1 hsa-391.1 hsa-5040.1 hsa-2316-1384.1 hsa-6903.1 |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Londin et al. | Proc. Natl. Acad. Sci. U.S.A. | 2015 | 25713380 | Analysis of 13 cell types reveals evidence for the expression of numerous novel primate- and tissue-specific microRNAs. |