| Accession | hsa-4326.1 |
| Organism | Homo sapiens |
| Genome | GRCh38.p10 |
| Location | 14:101,060,573-101,060,674 (+) |
| miRNA | m-4326 |
| Sequence (5' -> 3') (102 nts) |
CCCAAGUCAGGUACUCGAAUGGAGGUUGUCCAUGGUGUGUUCAUUUUAUUUAUGAUGAGUAUUACAUGGCCAAUCUCCUUUCGGUACUCAAUUCUUCUUGGG |
| MFE | -43.90 kcal/mol |
| first miRCarta version | 1.0 |
| last miRCarta version | 1.1 |
| Clusters (10 kb) (16 precursors) |
hsa-670-734.1
hsa-274-513.1 hsa-132-681.1 hsa-2030-964.1 hsa-730-435.1 hsa-1662-436.1 hsa-439-590.1 hsa-562.1 hsa-4326.1 hsa-515-584.1 hsa-1071-808.1 hsa-329-233.1 hsa-496-1601.1 hsa-442-393.1 hsa-1129-302.1 hsa-1328-690.1 |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Londin et al. | Proc. Natl. Acad. Sci. U.S.A. | 2015 | 25713380 | Analysis of 13 cell types reveals evidence for the expression of numerous novel primate- and tissue-specific microRNAs. |