| Accession | hsa-4138.1 |
| Organism | Homo sapiens |
| Genome | GRCh38.p10 |
| Location | 14:101,046,449-101,046,538 (+) |
| miRNA | m-4138 |
| Sequence (5' -> 3') (90 nts) |
UAACCUUUGGUACUUGGAGAGUGGUUAUCCCUGUCCUGUUCGUUUUGCUCAUGUCGAAUCGUACAGGGUCAUCCACUUUUUCAGUAUCAA |
| MFE | -33.20 kcal/mol |
| first miRCarta version | 1.0 |
| last miRCarta version | 1.1 |
| Clusters (10 kb) (22 precursors) |
hsa-804-384.1
hsa-3142.1 hsa-986-469.1 hsa-473-230.1 hsa-814-636.1 hsa-599-469.1 hsa-1725.1 hsa-927-922.1 hsa-927-1029.1 hsa-818-161.1 hsa-4138.1 hsa-1049-383.1 hsa-433-691.1 hsa-1169-285.1 hsa-935.1 hsa-1263-532.1 hsa-670-734.1 hsa-274-513.1 hsa-132-681.1 hsa-2030-964.1 hsa-730-435.1 hsa-1662-436.1 |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Londin et al. | Proc. Natl. Acad. Sci. U.S.A. | 2015 | 25713380 | Analysis of 13 cell types reveals evidence for the expression of numerous novel primate- and tissue-specific microRNAs. |