| Accession | hsa-3142.1 |
| Organism | Homo sapiens |
| Genome | GRCh38.p10 |
| Location | 14:101,039,852-101,039,908 (+) |
| miRNA | m-3142 |
| Sequence (5' -> 3') (57 nts) |
UCGGUGGACCUCAGAACAUGUGCUGAAUUCGUGCCAUAUGUCUGCGGACCACCCACC |
| MFE | -22.50 kcal/mol |
| first miRCarta version | 1.0 |
| last miRCarta version | 1.1 |
| Clusters (10 kb) (20 precursors) |
hsa-1716.1
hsa-3003.1 hsa-579.1 hsa-1085-356.1 hsa-804-384.1 hsa-3142.1 hsa-986-469.1 hsa-473-230.1 hsa-814-636.1 hsa-599-469.1 hsa-1725.1 hsa-927-922.1 hsa-927-1029.1 hsa-818-161.1 hsa-4138.1 hsa-1049-383.1 hsa-433-691.1 hsa-1169-285.1 hsa-935.1 hsa-1263-532.1 |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Londin et al. | Proc. Natl. Acad. Sci. U.S.A. | 2015 | 25713380 | Analysis of 13 cell types reveals evidence for the expression of numerous novel primate- and tissue-specific microRNAs. |