| Accession | hsa-3003.1 |
| Organism | Homo sapiens |
| Genome | GRCh38.p10 |
| Location | 14:101,031,998-101,032,064 (+) |
| miRNA | m-3003 |
| Sequence (5' -> 3') (67 nts) |
AAGUUGCCCGUGUUUUUUUCGCUUUAUUUGUGACGAAACAUUCGCGGUGCACUUCUUUUUCAGUAUC |
| MFE | -14.70 kcal/mol |
| first miRCarta version | 1.0 |
| last miRCarta version | 1.1 |
| Clusters (10 kb) (22 precursors) |
hsa-101-645.1
hsa-319-555.1 hsa-43803-43804.1 hsa-486-686.1 hsa-762-960.1 hsa-971.1 hsa-1010-441.1 hsa-422-334.1 hsa-1247-586.1 hsa-1247-586.2 hsa-1315-529.1 hsa-1716.1 hsa-3003.1 hsa-579.1 hsa-1085-356.1 hsa-804-384.1 hsa-3142.1 hsa-986-469.1 hsa-473-230.1 hsa-814-636.1 hsa-599-469.1 hsa-1725.1 |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Londin et al. | Proc. Natl. Acad. Sci. U.S.A. | 2015 | 25713380 | Analysis of 13 cell types reveals evidence for the expression of numerous novel primate- and tissue-specific microRNAs. |