| Accession | hsa-2985.1 |
| Organism | Homo sapiens |
| Genome | GRCh38.p10 |
| Location | 13:91,350,884-91,350,972 (+) |
| miRNA | m-2985 |
| Sequence (5' -> 3') (89 nts) |
UUUGUUUGCAGUCCUCUGUUAGUUUUGCAUAGUUGCACUACAAGAAGAAUGUAGUUGUGCAAAUCUAUGCAAAACUGAUGGUGGCCUGC |
| MFE | -38.70 kcal/mol |
| first miRCarta version | 1.0 |
| last miRCarta version | 1.1 |
| Clusters (10 kb) (7 precursors) |
hsa-88-113.1
hsa-262-389.1 hsa-2985.1 hsa-1070-201.1 hsa-96-341.1 hsa-363-122.1 hsa-409-9.1 |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Londin et al. | Proc. Natl. Acad. Sci. U.S.A. | 2015 | 25713380 | Analysis of 13 cell types reveals evidence for the expression of numerous novel primate- and tissue-specific microRNAs. |