| Accession | MI0031513 | ||||
| Name | hsa-mir-3670-3 | ||||
| similar to following miRCarta precursors | hsa-2592.3 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr16:18,405,698-18,405,762 (-) |
||||
| miRNA | hsa-miR-3670 | ||||
| Sequence (5' -> 3') (65 nts) |
UCUAGACUGGUAUAGCUGCUUUUGGAGCCUCACCUGCUGAGAGCUCACAGCUGUCCUUCUCUAGA | ||||
| MFE | -24.20 kcal/mol | ||||
| first miRBase version | 21.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (3 precursors) |
hsa-mir-3180-3
hsa-mir-3670-3 hsa-mir-3179-3 |
||||
| Family | mir-3670 (MIPF0001340) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Vaz et al. | BMC Genomics | 2010 | 20459673 | Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood. |