Accession | MI0031492 |
Name | oha-mir-92a-2 |
similar to following miRCarta precursors | oha-11.1 |
Organism | Ophiophagus hannah |
Genome | OphHan1.0 |
Location |
AZIM01002644.1:179,818-179,909 (+) |
miRNA | oha-miR-92a |
Sequence (5' -> 3') (92 nts) |
UCUUCCUCCCUGGGUUGGGAUCAGUUGUAUUACUCGGACGUCUCUGAACAGUAUUGCACUUGUCCCGGCCUGUGGAGGGUGAGGGGAGGACC |
MFE | -39.20 kcal/mol |
first miRBase version | 21.0 |
last miRBase version | 21.0 |
Clusters (10 kb) (4 precursors) |
oha-mir-18b
oha-mir-20b oha-mir-92a-2 oha-mir-363 |
Family | mir-25 (MIPF0000013) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Vonk et al. | Proc. Natl. Acad. Sci. U.S.A. | 2013 | 24297900 | The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system. |